Stem-loop sequence gga-mir-7461

AccessionMI0024131 (change log)
DescriptionGallus gallus miR-7461 stem-loop
Stem-loop
   --          g --ca  ag   a   u   gugg  g     g 
5'   ucugugauca g    gg  aug uga cug    ca uuacg a
     |||||||||| |    ||  ||| ||| |||    || |||||  
3'   agguacuggu u    uc  uac acu gac    gu ggugc g
   gu          g aagg  gg   -   c   -agg  -     a 
Get sequence
Deep sequencing
409 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 969748-969834 [-]
intergenic
chr2: 974737-974823 [-]
intergenic
chr2: 979726-979812 [-]
intergenic
chr2: 986863-986949 [-]
intergenic
Database links

Mature sequence gga-miR-7461-5p

Accession MIMAT0029076
Sequence

1 - 

ucugugaucaggcaggagaugau

 - 23

Get sequence
Deep sequencing223 reads, 1 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

Mature sequence gga-miR-7461-3p

Accession MIMAT0029077
Sequence

63 - 

cauggcuggaauguggucauggaug

 - 87

Get sequence
Deep sequencing41 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).