Stem-loop sequence gga-mir-7460

AccessionMI0024130 (change log)
DescriptionGallus gallus miR-7460 stem-loop
Literature search

1 open access papers mention gga-mir-7460
(1 sentences)

Stem-loop
   --  u        cc    a u a   -  ag 
5'   ga ggcagagc  ucag c g ggc cg  c
     || ||||||||  |||| | | ||| ||  u
3'   cu ucgucucg  aguc g c ccg gu  c
   cu  u        --    a u -   u  gu 
Get sequence
Deep sequencing
66 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr13: 10375306-10375366 [-]
sense
ENSGALT00000005196 ; CDHR2-201; intron 5
Database links

Mature sequence gga-miR-7460-5p

Accession MIMAT0029074
Sequence

1 - 

gauggcagagcccucagacugaggc

 - 25

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7460-3p

Accession MIMAT0029075
Sequence

40 - 

ccugacugagcucugcuuucuc

 - 61

Get sequence
Deep sequencing60 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).