Stem-loop sequence gga-mir-7459

AccessionMI0024129 (change log)
DescriptionGallus gallus miR-7459 stem-loop
Stem-loop
   -g     gag     -  u      uuuca   a 
5'   gcuuu   acagu cu ucucag     gag c
     |||||   ||||| || ||||||     ||| u
3'   cggag   uguca ga aggguc     cuc c
   ug     -ua     u  u      ucccc   u 
Get sequence
Deep sequencing
314 reads, 200 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 57947959-57948026 [+]
intergenic
Database links

Mature sequence gga-miR-7459-5p

Accession MIMAT0029072
Sequence

1 - 

ggcuuugagacagucuuucucagu

 - 24

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7459-3p

Accession MIMAT0029073
Sequence

46 - 

ugggauaguacuguaugaggcgu

 - 68

Get sequence
Deep sequencing313 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).