Stem-loop sequence gga-mir-7457

AccessionMI0024127 (change log)
DescriptionGallus gallus miR-7457 stem-loop
Stem-loop
   --   auu      g  g  auc     ca 
5'   ggc   cauagg cu ug   ggugg  g
     |||   |||||| || ||   |||||   
3'   ucg   gugucc ga gu   ucauc  a
   ga   ---      g  g  ---     ua 
Get sequence
Deep sequencing
548 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 44141501-44141554 [+]
intergenic
Database links

Mature sequence gga-miR-7457-5p

Accession MIMAT0029068
Sequence

1 - 

ggcauucauagggcugugaucgg

 - 23

Get sequence
Deep sequencing242 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7457-3p

Accession MIMAT0029069
Sequence

35 - 

acuuggaggccuguggcuag

 - 54

Get sequence
Deep sequencing105 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).