Stem-loop sequence gga-mir-7456

AccessionMI0024126 (change log)
DescriptionGallus gallus miR-7456 stem-loop
Stem-loop
   --       c       u    a   gac 
5'   ccugcag ugcauuu cccu ugu   c
     ||||||| ||||||| |||| |||   c
3'   ggauguc auguaga ggga acg   g
   ga       c       -    c   auc 
Get sequence
Deep sequencing
191 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 115467760-115467817 [-]
intergenic
Database links

Mature sequence gga-miR-7456-5p

Accession MIMAT0029066
Sequence

1 - 

ccugcagcugcauuuucccuaug

 - 23

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7456-3p

Accession MIMAT0029067
Sequence

37 - 

cagggagauguaccuguaggag

 - 58

Get sequence
Deep sequencing190 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).