Stem-loop sequence gga-mir-7454

AccessionMI0024124 (change log)
DescriptionGallus gallus miR-7454 stem-loop
Stem-loop
   --u     --ga a   a   --     c 
5'    ucugu    g caa cug  aagug u
      |||||    | ||| |||  ||||| a
3'    agacg    c guu gac  uucac c
   gac     aaag -   c   cu     a 
Get sequence
Deep sequencing
230 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr26: 5270406-5270459 [-]
intergenic
Database links

Mature sequence gga-miR-7454-5p

Accession MIMAT0029062
Sequence

1 - 

uucugugagacaaacugaagugc

 - 23

Get sequence
Deep sequencing228 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7454-3p

Accession MIMAT0029063
Sequence

29 - 

acuuuccagcuugcgaaagcagacag

 - 54

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).