Stem-loop sequence gga-mir-7453

AccessionMI0024123 (change log)
DescriptionGallus gallus miR-7453 stem-loop
Stem-loop
   --     ugu     cuc   a  g u    a  g 
5'   ucaga   gagaa   agc gc c uggu cu g
     |||||   |||||   ||| || | |||| ||  
3'   ggucu   cucuu   ucg cg g acua gg u
   uc     ---     --u   a  g u    -  u 
Get sequence
Deep sequencing
21141 reads, 5.13e+03 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr20: 2070245-2070308 [-]
intergenic
Database links

Mature sequence gga-miR-7453-5p

Accession MIMAT0029060
Sequence

1 - 

ucagaugugagaacucagcagcg

 - 23

Get sequence
Deep sequencing20791 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7453-3p

Accession MIMAT0029061
Sequence

47 - 

cagcuuuucucucuggcu

 - 64

Get sequence
Deep sequencing61 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).