Stem-loop sequence gga-mir-7452

AccessionMI0024122 (change log)
DescriptionGallus gallus miR-7452 stem-loop
Stem-loop
   ---a         ----cu          cuu   c 
5'     cagggcugg      gauccgugca   uca u
       |||||||||      ||||||||||   ||| u
3'     guccugacc      uuaggcgcgu   agu a
   cguc         aaguuc          ugu   a 
Get sequence
Deep sequencing
88 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 106605861-106605928 [+]
sense
ENSGALT00000025834 ; gga-mir-7452-201; 3'UTR (exon 17)
Database links

Mature sequence gga-miR-7452-5p

Accession MIMAT0029058
Sequence

1 - 

acagggcuggcugauccgugc

 - 21

Get sequence
Deep sequencing87 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7452-3p

Accession MIMAT0029059
Sequence

43 - 

gcggauucuugaaccaguccugcugc

 - 68

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).