Stem-loop sequence gga-mir-7451

AccessionMI0024121 (change log)
DescriptionGallus gallus miR-7451 stem-loop
Stem-loop
   --c      au      -u       ugu 
5'    guggga  uaagag  ggcaguc   u
      ||||||  ||||||  |||||||    
3'    cacccu  auucuu  ucguuag   a
   uga      --      cu       uac 
Get sequence
Deep sequencing
21 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 67209491-67209545 [+]
sense
ENSGALT00000022697 ; LRMP-201; intron 11
Database links

Mature sequence gga-miR-7451-5p

Accession MIMAT0029056
Sequence

1 - 

cgugggaauuaagaguggcaguc

 - 23

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7451-3p

Accession MIMAT0029057
Sequence

34 - 

uugcuucuucuuaucccacagu

 - 55

Get sequence
Deep sequencing21 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).