Stem-loop sequence gga-mir-7450

AccessionMI0024118 (change log)
DescriptionGallus gallus miR-7450 stem-loop
Literature search

1 open access papers mention gga-mir-7450
(40 sentences)

Stem-loop
   --      -   -a       u a   u 
5'   ucuguu cuu  aggaggc g ggc g
     |||||| |||  ||||||| | ||| u
3'   agguag gaa  uccuuug c cug u
   cg      u   gg       c -   g 
Get sequence
Deep sequencing
2537 reads, 850 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 54784281-54784334 [+]
intergenic
chr1: 54793873-54793926 [+]
intergenic
Database links

Mature sequence gga-miR-7450-5p

Accession MIMAT0029054
Sequence

1 - 

ucuguucuuaaggaggcugaggc

 - 23

Get sequence
Deep sequencing2527 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7450-3p

Accession MIMAT0029055
Sequence

31 - 

cccguuuccuggaagugauggagc

 - 54

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).