Stem-loop sequence gga-mir-7449

AccessionMI0024117 (change log)
DescriptionGallus gallus miR-7449 stem-loop
Stem-loop
   --  gu     a         cc   ca   aaca 
5'   ag  caucu guccaacuu  cug  aug    u
     ||  ||||| |||||||||  |||  |||     
3'   uc  guaga cagguuggg  gac  uac    g
   uu  ug     g         -a   -a   acau 
Get sequence
Deep sequencing
53 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 182377259-182377326 [-]
sense
ENSGALT00000027753 ; DYNC2H1-201; intron 5
Database links

Mature sequence gga-miR-7449-5p

Accession MIMAT0029052
Sequence

1 - 

aggucaucuaguccaacuuccc

 - 22

Get sequence
Deep sequencing17 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7449-3p

Accession MIMAT0029053
Sequence

47 - 

aggguuggacgagauggucuuu

 - 68

Get sequence
Deep sequencing31 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).