Stem-loop sequence gga-mir-7448

AccessionMI0024115 (change log)
DescriptionGallus gallus miR-7448 stem-loop
Stem-loop
   cucauc    a  g   c     acg  c 
5'       cucc ug ucu cagca   cc u
         |||| || ||| |||||   ||  
3'       gagg ac aga guugu   gg c
   --cgaa    -  a   u     caa  a 
Get sequence
Deep sequencing
7053 reads, 1.15e+03 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 126122759-126122815 [-]
intergenic
Database links

Mature sequence gga-miR-7448-5p

Accession MIMAT0029050
Sequence

1 - 

cucauccuccauggucuccagcaacgcc

 - 28

Get sequence
Deep sequencing25 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7448-3p

Accession MIMAT0029051
Sequence

35 - 

aacuguuguagaacaggagaagc

 - 57

Get sequence
Deep sequencing7012 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).