Stem-loop sequence gga-mir-7447

AccessionMI0024114 (change log)
DescriptionGallus gallus miR-7447 stem-loop
Stem-loop
   --aa      uag   u    g u   aauu 
5'     aguugg   uga ugcu a gug    c
       ||||||   ||| |||| | |||    u
3'     ucaacc   acu acga u cac    g
   aucc      -cg   c    g c   caga 
Get sequence
Deep sequencing
49 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 29613912-29613973 [+]
sense
ENSGALT00000015537 ; PPHLN1-201; intron 7
Database links

Mature sequence gga-miR-7447-5p

Accession MIMAT0029048
Sequence

1 - 

aaaguugguagugauugcugaug

 - 23

Get sequence
Deep sequencing48 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7447-3p

Accession MIMAT0029049
Sequence

41 - 

ugagcacucagcccaacuccua

 - 62

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).