Stem-loop sequence gga-mir-7446

AccessionMI0024113 (change log)
DescriptionGallus gallus miR-7446 stem-loop
Stem-loop
   cg  a g  -   c     -gcg  u     u 
5'   cc u uc cac uccgc    ca gcgcc c
     || | || ||| |||||    || ||||| a
3'   gg g ag gug aggcg    gu cgcgg a
   -g  a g  u   c     guaa  -     g 
Get sequence
Deep sequencing
38 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 88559233-88559295 [-]
antisense
ENSGALT00000024813 ; ABHD10-201; 3'UTR (exon 1)
Database links

Mature sequence gga-miR-7446-5p

Accession MIMAT0029046
Sequence

1 - 

cgccauguccaccuccgcgc

 - 20

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7446-3p

Accession MIMAT0029047
Sequence

46 - 

gcggacgugugaggaggg

 - 63

Get sequence
Deep sequencing33 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).