Stem-loop sequence gga-mir-7445-1

AccessionMI0024111 (change log)
DescriptionGallus gallus miR-7445-1 stem-loop
Gene family MIPF0001857; mir-7445
Stem-loop
   --                        g ca 
5'   aaaguuaaacagacucauccacga a  c
     |||||||||||||||||||||||| |   
3'   uuucaauuugucugaguagguguu u  u
   ua                        g cc 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 161765494-161765553 [+]
intergenic
AADN04015473.1: 1646-1705 [-]
intergenic
Clustered miRNAs
< 10kb from gga-mir-7445-1
gga-mir-7445-2chr1: 161765492-161765551 [-]
gga-mir-7445-1chr1: 161765494-161765553 [+]
Database links

Mature sequence gga-miR-7445-5p

Accession MIMAT0029044
Sequence

1 - 

aaaguuaaacagacucauccac

 - 22

Get sequence
Deep sequencing12 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7445-3p

Accession MIMAT0029045
Sequence

39 - 

ggaugagucuguuuaacuuuau

 - 60

Get sequence
Deep sequencing55 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).