Stem-loop sequence gga-mir-7444

AccessionMI0024110 (change log)
DescriptionGallus gallus miR-7444 stem-loop
Stem-loop
   --        c u      -    uu ca  c 
5'   guaaggcu c ucugac cucc  g  cu u
     |||||||| | |||||| ||||  |  ||  
3'   cguuccga g ggauug gagg  c  gg c
   gu        c u      u    uc ag  u 
Get sequence
Deep sequencing
18 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr19: 2914228-2914290 [-]
intergenic
Database links

Mature sequence gga-miR-7444-5p

Accession MIMAT0029042
Sequence

1 - 

guaaggcuccuucugaccucc

 - 21

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7444-3p

Accession MIMAT0029043
Sequence

42 - 

aguguuaggugcagccuugcug

 - 63

Get sequence
Deep sequencing11 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).