Stem-loop sequence gga-mir-7443

AccessionMI0024109 (change log)
DescriptionGallus gallus miR-7443 stem-loop
Stem-loop
   ---u    g    -c       a    c au 
5'     ggug cugc  cucaggg gagc g  u
       |||| ||||  ||||||| |||| |  c
3'     ccac gacg  ggguucc cucg c  c
   ccuc    -    uc       -    a cc 
Get sequence
Deep sequencing
643 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr18: 9815975-9816033 [+]
intergenic
Database links

Mature sequence gga-miR-7443-5p

Accession MIMAT0029040
Sequence

1 - 

ugguggcugcccucagggagagc

 - 23

Get sequence
Deep sequencing636 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7443-3p

Accession MIMAT0029041
Sequence

37 - 

ucccuugggcugcagcacccucc

 - 59

Get sequence
Deep sequencing7 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).