Stem-loop sequence gga-mir-7442

AccessionMI0024108 (change log)
DescriptionGallus gallus miR-7442 stem-loop
Stem-loop
   --ca     ccau       u   -  ccu 
5'     cagga    gggagcg ggc ca   u
       |||||    ||||||| ||| ||    
3'     guccu    ccuucgu ucg gu   g
   cgac     -ccu       c   a  ccc 
Get sequence
Deep sequencing
110 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr17: 2943356-2943413 [+]
sense
ENSGALT00000011649 ; STXBP1-201; intron 4
AADN04014272.1: 3461-3518 [-]
sense
ENSGALT00000011649 ; STXBP1-201; intron 4
Database links

Mature sequence gga-miR-7442-5p

Accession MIMAT0029038
Sequence

1 - 

cacaggaccaugggagcguggc

 - 22

Get sequence
Deep sequencing96 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7442-3p

Accession MIMAT0029039
Sequence

38 - 

ucugcuuccuccuccugcagc

 - 58

Get sequence
Deep sequencing14 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).