Stem-loop sequence gga-mir-7440

AccessionMI0024106 (change log)
DescriptionGallus gallus miR-7440 stem-loop
Stem-loop
   --     ga  --     ---ug g          gg 
5'   uguuu  gu  gcacc     g ugcuacaggu  u
     |||||  ||  |||||     | ||||||||||   
3'   acagg  cg  ugugg     c acgauguccg  g
   cg     ac  ga     uuuua g          ug 
Get sequence
Deep sequencing
81 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 64670256-64670324 [+]
intergenic
Database links

Mature sequence gga-miR-7440-5p

Accession MIMAT0029034
Sequence

1 - 

uguuugagugcaccugggu

 - 19

Get sequence
Deep sequencing37 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7440-3p

Accession MIMAT0029035
Sequence

49 - 

uuugguguaggccaggacagc

 - 69

Get sequence
Deep sequencing35 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).