Stem-loop sequence gga-mir-7439

AccessionMI0024105 (change log)
DescriptionGallus gallus miR-7439 stem-loop
Literature search

1 open access papers mention gga-mir-7439
(2 sentences)

Stem-loop
   -ug   ug     -  g   ag   caaa       gg 
5'    acu  ggaac au gga  agg    aggcaag  a
      |||  ||||| || |||  |||    |||||||   
3'    uga  ccuug ug ccu  ucc    uucguuu  a
   ucg   gu     a  a   cu   --uc       ga 
Get sequence
Deep sequencing
217 reads, 100 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 40652255-40652328 [-]
intergenic
Database links

Mature sequence gga-miR-7439-5p

Accession MIMAT0029032
Sequence

1 - 

ugacuugggaacaugggaagagg

 - 23

Get sequence
Deep sequencing204 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7439-3p

Accession MIMAT0029033
Sequence

52 - 

uucuccaguaguuccugagugcu

 - 74

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).