Stem-loop sequence gga-mir-7438

AccessionMI0024104 (change log)
DescriptionGallus gallus miR-7438 stem-loop
Stem-loop
   --uuu    a              --g    ac 
5'      uuca ggggacaacucaga   cagg  g
        |||| ||||||||||||||   ||||  c
3'      aagu cuucuguugaguuu   guuu  u
   uugau    c              aug    ca 
Get sequence
Deep sequencing
151 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 70775549-70775613 [+]
sense
ENSGALT00000003296 ; TSTD2-201; intron 3
Database links

Mature sequence gga-miR-7438-5p

Accession MIMAT0029030
Sequence

1 - 

uuuuucaaggggacaacucaga

 - 22

Get sequence
Deep sequencing134 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7438-3p

Accession MIMAT0029031
Sequence

44 - 

ugaguugucuuccugaauaguu

 - 65

Get sequence
Deep sequencing17 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).