Stem-loop sequence gga-mir-7437

AccessionMI0024103 (change log)
DescriptionGallus gallus miR-7437 stem-loop
Stem-loop
   -  -  a   c      a  u  -  gaaauaa    u g 
5'  ga ac gag guugga gg ag gg       gagu g u
    || || ||| |||||| || || ||       |||| | u
3'  cu ug cuc caaccu cc uc cc       cuca c g
   a  a  a   -      -  u  a  --acgaa    - a 
Get sequence
Deep sequencing
75 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chrZ: 68483506-68483580 [+]
intergenic
Database links

Mature sequence gga-miR-7437-5p

Accession MIMAT0029028
Sequence

1 - 

gaacagagcguuggaagguaggg

 - 23

Get sequence
Deep sequencing74 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-7437-3p

Accession MIMAT0029029
Sequence

55 - 

cuuccuccaaccucaguauca

 - 75

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).