Stem-loop sequence oan-mir-7436

AccessionMI0024101 (change log)
DescriptionOrnithorhynchus anatinus miR-7436 stem-loop
Stem-loop
   --aa          u         uccaa 
5'     guguuuuaga uguacaugu     a
       |||||||||| |||||||||     c
3'     cacaagaucu acgugugua     u
   aguc          c         cuuua 
Get sequence
Deep sequencing
38 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
X2: 4550552-4550610 [+]
intergenic
Database links

Mature sequence oan-miR-7436-5p

Accession MIMAT0029026
Sequence

1 - 

aaguguuuuagauuguacaugu

 - 22

Get sequence
Deep sequencing9 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7436-3p

Accession MIMAT0029027
Sequence

38 - 

gugugcacucuagaacaccuga

 - 59

Get sequence
Deep sequencing29 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).