Stem-loop sequence oan-mir-7435

AccessionMI0024100 (change log)
DescriptionOrnithorhynchus anatinus miR-7435 stem-loop
Stem-loop
   --         ug a         agu  a 
5'   ugggauuug  u ugugauugc   ug u
     |||||||||  | |||||||||   || g
3'   acucuaaau  a acauuaaug   ac u
   ug         gu c         -au  u 
Get sequence
Deep sequencing
167 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
X1: 36183342-36183401 [+]
sense
Database links

Mature sequence oan-miR-7435-5p

Accession MIMAT0029024
Sequence

1 - 

ugggauuuguguaugugauugc

 - 22

Get sequence
Deep sequencing159 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7435-3p

Accession MIMAT0029025
Sequence

39 - 

aauuacacauguaaaucucagu

 - 60

Get sequence
Deep sequencing8 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).