Stem-loop sequence oan-mir-7422b

AccessionMI0024099 (change log)
DescriptionOrnithorhynchus anatinus miR-7422b stem-loop
Stem-loop
   --a  gg   -   g ug   -     uu 
5'    gg  agu gcu u  gag uggcu  g
      ||  ||| ||| |  ||| |||||  a
3'    cc  uca cga a  cuc accga  u
   cua  uu   a   - gu   c     cu 
Get sequence
Deep sequencing
60 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
X1: 29460306-29460361 [+]
intergenic
Database links

Mature sequence oan-miR-7422b-5p

Accession MIMAT0029022
Sequence

1 - 

aggggagugcuguuggaguggc

 - 22

Get sequence
Deep sequencing26 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7422b-3p

Accession MIMAT0029023
Sequence

34 - 

caccucugaagcaacuuuccauc

 - 56

Get sequence
Deep sequencing34 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).