Stem-loop sequence oan-mir-216b

AccessionMI0024098 (change log)
DescriptionOrnithorhynchus anatinus miR-216b stem-loop
Gene family MIPF0000054; mir-216
Stem-loop
   --a         u  c  a    ---g   ca 
5'    aaucucugc gg aa ugug    ugu  c
      ||||||||| || || ||||    |||  g
3'    uuagagaug cc uu acac    acg  g
   guc         u  a  a    gcua   au 
Get sequence
Deep sequencing
2410 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra56: 1124133-1124194 [-]
sense
ENSOANT00000026124 ; oan-mir-216b-201; exon 1
Clustered miRNAs
< 10kb from oan-mir-216b
oan-mir-216bUltra56: 1124133-1124194 [-]
oan-mir-216aUltra56: 1115641-1115763 [-]
Database links

Mature sequence oan-miR-216b-5p

Accession MIMAT0029020
Sequence

1 - 

aaaucucugcuggcaaaugugg

 - 22

Get sequence
Deep sequencing2226 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-216b-3p

Accession MIMAT0029021
Sequence

41 - 

acaauuaccuguagagauucug

 - 62

Get sequence
Deep sequencing184 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).