Stem-loop sequence oan-mir-7434

AccessionMI0024097 (change log)
DescriptionOrnithorhynchus anatinus miR-7434 stem-loop
Stem-loop
   --uguuucc -     c          aagag 
5'          g cugug cauuugugga     u
            | ||||| ||||||||||      
3'          c ggcau guaaacaucu     u
   ggguagaaa a     u          aagau 
Get sequence
Deep sequencing
246 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
3: 6956214-6956276 [+]
sense
ENSOANT00000017894 ; oan-mir-7434-201; 3'UTR (exon 5)
Database links

Mature sequence oan-miR-7434-5p

Accession MIMAT0029018
Sequence

2 - 

guuuccgcugugccauuug

 - 20

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7434-3p

Accession MIMAT0029019
Sequence

43 - 

aauguuacggacaaagaugg

 - 62

Get sequence
Deep sequencing208 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).