Stem-loop sequence oan-mir-7433

AccessionMI0024096 (change log)
DescriptionOrnithorhynchus anatinus miR-7433 stem-loop
Stem-loop
   --       u  -       ug   uu 
5'   uggucac gu cagucau  ugu  c
     ||||||| || |||||||  |||  a
3'   aucagug ca guuagua  aca  a
   cc       u  u       gu   cc 
Get sequence
Deep sequencing
1194 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra505: 1482827-1482880 [-]
sense
Database links

Mature sequence oan-miR-7433-5p

Accession MIMAT0029016
Sequence

1 - 

uggucacugucagucauugugu

 - 22

Get sequence
Deep sequencing7 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7433-3p

Accession MIMAT0029017
Sequence

32 - 

augaugauuguacugugacuacc

 - 54

Get sequence
Deep sequencing1187 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).