Stem-loop sequence oan-mir-7432

AccessionMI0024095 (change log)
DescriptionOrnithorhynchus anatinus miR-7432 stem-loop
Stem-loop
   --       g                uua 
5'   agcaaau aauaucuguccuggaa   c
     ||||||| ||||||||||||||||   c
3'   ucguuua uuauagacaggaccuu   u
   ag       g                uag 
Get sequence
Deep sequencing
42 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
3: 58986417-58986475 [+]
sense
Database links

Mature sequence oan-miR-7432-5p

Accession MIMAT0029014
Sequence

1 - 

agcaaaugaauaucuguccugg

 - 22

Get sequence
Deep sequencing12 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7432-3p

Accession MIMAT0029015
Sequence

38 - 

aggacagauauugauuugcuga

 - 59

Get sequence
Deep sequencing30 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).