Stem-loop sequence oan-mir-7431

AccessionMI0024094 (change log)
DescriptionOrnithorhynchus anatinus miR-7431 stem-loop
Stem-loop
   --caa   a  -    cc       ac 
5'      cgg cu cacu  cuucugu  c
        ||| || ||||  |||||||  a
3'      gcc ga guga  gaagaca  g
   aggaa   a  a    aa       cc 
Get sequence
Deep sequencing
47 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra482: 1607290-1607343 [-]
sense
ENSOANT00000007628 ; oan-mir-7431-201; 3'UTR (exon 25)
Database links

Mature sequence oan-miR-7431-5p

Accession MIMAT0029012
Sequence

1 - 

caacggacucacucccuucug

 - 21

Get sequence
Deep sequencing44 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7431-3p

Accession MIMAT0029013
Sequence

33 - 

gaagaaagugaagaccgaagga

 - 54

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).