Stem-loop sequence oan-mir-30c-1

AccessionMI0024093 (change log)
DescriptionOrnithorhynchus anatinus miR-30c-1 stem-loop
Gene family MIPF0000005; mir-30
Stem-loop
   --u       u   aca         gu aa 
5'    guaaaca ccu   cucucagcu  c  g
      ||||||| |||   |||||||||  |  u
3'    cauuugu ggg   gagggucgg  g  c
   ccu       u   --a         ag aa 
Get sequence
Deep sequencing
114155 reads, 1.98e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra467: 480344-480404 [-]
sense
ENSOANT00000026166 ; oan-mir-30c-1-201; exon 1
ENSOANT00000019573 ; NFYC-201; intron 4
Clustered miRNAs
< 10kb from oan-mir-30c-1
oan-mir-30eUltra467: 482269-482363 [-]
oan-mir-30c-1Ultra467: 480344-480404 [-]
Database links

Mature sequence oan-miR-30c-5p

Accession MIMAT0006911
Previous IDsoan-miR-30c
Sequence

1 - 

uguaaacauccuacacucucagc

 - 23

Get sequence
Deep sequencing227321 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-30c-1-3p

Accession MIMAT0031028
Sequence

41 - 

ugggagaggguuguuuacucc

 - 61

Get sequence
Deep sequencing518 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).