Stem-loop sequence oan-mir-7430

AccessionMI0024092 (change log)
DescriptionOrnithorhynchus anatinus miR-7430 stem-loop
Stem-loop
   --u  -    a         gaaa  agu 
5'    gg gcag ucuccucuu    cu   c
      || |||| |||||||||    ||    
3'    cc cguu aggggaggg    ga   u
   uuu  a    g         -aac  aaa 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra443: 6812403-6812458 [-]
intergenic
Clustered miRNAs
< 10kb from oan-mir-7430
oan-mir-135aUltra443: 6813027-6813135 [-]
oan-mir-7430Ultra443: 6812403-6812458 [-]
Database links

Mature sequence oan-miR-7430-5p

Accession MIMAT0029010
Sequence

1 - 

ugggcagaucuccucuugaaac

 - 22

Get sequence
Deep sequencing38 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7430-3p

Accession MIMAT0029011
Sequence

34 - 

caagggaggggaguugcaccuuu

 - 56

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).