Stem-loop sequence oan-mir-7429

AccessionMI0024091 (change log)
DescriptionOrnithorhynchus anatinus miR-7429 stem-loop
Stem-loop
   --         au       c  aau   u 
5'   uccaugugg  gguccaa ug   gau u
     |||||||||  ||||||| ||   |||  
3'   agguacauc  ucagguu ac   cug a
   ug         cg       u  ---   a 
Get sequence
Deep sequencing
13 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra440: 699171-699227 [-]
sense
Database links

Mature sequence oan-miR-7429-5p

Accession MIMAT0029008
Sequence

2 - 

ccauguggaugguccaacug

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7429-3p

Accession MIMAT0029009
Sequence

37 - 

uuuggacugccuacauggag

 - 56

Get sequence
Deep sequencing13 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).