Stem-loop sequence oan-mir-7428

AccessionMI0024090 (change log)
DescriptionOrnithorhynchus anatinus miR-7428 stem-loop
Stem-loop
   --    u   -             a uca 
5'   uaaa cag ucaucagucagag c   g
     |||| ||| ||||||||||||| |   u
3'   auuu guu agugguuagucuc g   a
   cg    c   u             c uaa 
Get sequence
Deep sequencing
40 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra341: 840277-840334 [+]
sense
ENSOANT00000001326 ; ATP1B1-201; intron 1
Database links

Mature sequence oan-miR-7428-5p

Accession MIMAT0029006
Sequence

1 - 

uaaaucagucaucagucagaga

 - 22

Get sequence
Deep sequencing23 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7428-3p

Accession MIMAT0029007
Sequence

36 - 

ucugauuggugauuugcuuuagc

 - 58

Get sequence
Deep sequencing17 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).