Stem-loop sequence oan-mir-7427

AccessionMI0024089 (change log)
DescriptionOrnithorhynchus anatinus miR-7427 stem-loop
Stem-loop
   --u   -   --a     aaa  c          uuc 
5'    ggu gag   acaag   cg ggcgguggaa   u
      ||| |||   |||||   || ||||||||||    
3'    ccg uuc   uguuc   gc ucgucgccuu   c
   guc   g   guc     --g  -          cuc 
Get sequence
Deep sequencing
103 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra301: 79539-79606 [+]
sense
ENSOANT00000005739 ; oan-mir-7427-201; exon 2
Database links

Mature sequence oan-miR-7427-5p

Accession MIMAT0029004
Sequence

1 - 

uggugagaacaagaaacgcggcg

 - 23

Get sequence
Deep sequencing100 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7427-3p

Accession MIMAT0029005
Sequence

46 - 

cucggcuugucugcuuggcccug

 - 68

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).