Stem-loop sequence oan-mir-19b-2

AccessionMI0024088 (change log)
DescriptionOrnithorhynchus anatinus miR-19b-2 stem-loop
Gene family MIPF0000011; mir-19
Stem-loop
   --         -  -      uc    --u     
5'   aguuuugca gg uuugca  cagc   guau 
     ||||||||| || ||||||  ||||   ||| g
3'   ucaaaacgu cc aaacgu  gucg   caug 
   ag         a  u      --    ucu     
Get sequence
Deep sequencing
11581 reads, 180 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra284: 6728772-6728832 [+]
sense
ENSOANT00000025447 ; oan-mir-19b-2-201; exon 1
Clustered miRNAs
< 10kb from oan-mir-19b-2
oan-mir-17Ultra284: 6728095-6728179 [+]
oan-mir-19aUltra284: 6728409-6728548 [+]
oan-mir-20a-2Ultra284: 6728615-6728723 [+]
oan-mir-19b-2Ultra284: 6728772-6728832 [+]
oan-mir-92a-2Ultra284: 6728858-6728967 [+]
oan-mir-17Ultra284: 6730992-6731076 [+]
Database links

Mature sequence oan-miR-19b-2-5p

Accession MIMAT0031104
Sequence

1 - 

aguuuugcagguuugcauccagc

 - 23

Get sequence
Deep sequencing74 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-19b-3p

Accession MIMAT0006856
Previous IDsoan-miR-19b
Sequence

39 - 

ugugcaaauccaugcaaaacuga

 - 61

Get sequence
Deep sequencing23086 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).