Stem-loop sequence oan-mir-7426

AccessionMI0024087 (change log)
DescriptionOrnithorhynchus anatinus miR-7426 stem-loop
Stem-loop
   --   g   -   ccuc     c ag   g 
5'   ucu cau cau    cacuu u  ggg c
     ||| ||| |||    ||||| |  |||  
3'   aga gua gua    gugaa a  ucc a
   gg   g   a   ---a     c -g   a 
Get sequence
Deep sequencing
1193 reads, 633 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra275: 238334-238388 [-]
intergenic
Database links

Mature sequence oan-miR-7426-5p

Accession MIMAT0029002
Sequence

1 - 

ucugcaucauccuccacuucuagggg

 - 26

Get sequence
Deep sequencing6 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7426-3p

Accession MIMAT0029003
Sequence

33 - 

ugacaagugaaugaauggagagg

 - 55

Get sequence
Deep sequencing1187 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).