Stem-loop sequence oan-mir-153-2

AccessionMI0024086 (change log)
DescriptionOrnithorhynchus anatinus miR-153-2 stem-loop
Gene family MIPF0000050; mir-153
Stem-loop
   --             gu       -a  aa 
5'   ucauuuuugugau  ugcagcu  gu  u
     |||||||||||||  |||||||  ||  a
3'   agugaaaacacug  acguuga  cg  u
   cu             au       cc  ag 
Get sequence
Deep sequencing
7986 reads, 120 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra274: 11273442-11273501 [+]
sense
ENSOANT00000025977 ; oan-mir-153-2-201; exon 1
ENSOANT00000009791 ; PTPRN2-201; intron 8
Database links

Mature sequence oan-miR-153-2-5p

Accession MIMAT0031116
Sequence

1 - 

ucauuuuugugauguugcagcu

 - 22

Get sequence
Deep sequencing30 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-153-3p

Accession MIMAT0007005
Previous IDsoan-miR-153
Sequence

39 - 

uugcauagucacaaaagugauc

 - 60

Get sequence
Deep sequencing16283 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).