Stem-loop sequence oan-mir-7425

AccessionMI0024085 (change log)
DescriptionOrnithorhynchus anatinus miR-7425 stem-loop
Stem-loop
   --uuc        uaa g            ga  c   g 
5'      ucggcggu   c gccuauccgucg  uc ucu u
        ||||||||   | ||||||||||||  || ||| c
3'      agccgucg   g cggauaggcagu  ag gga a
   caguc        --- g            -g  c   a 
Get sequence
Deep sequencing
54 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra204: 1238797-1238871 [+]
sense
ENSOANT00000008885 ; NCAM2-201; intron 7
Database links

Mature sequence oan-miR-7425-5p

Accession MIMAT0029000
Sequence

1 - 

uucucggcgguuaacggccuauc

 - 23

Get sequence
Deep sequencing53 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7425-3p

Accession MIMAT0029001
Sequence

56 - 

uaggcgggcugccgacugac

 - 75

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).