Stem-loop sequence oan-mir-7424

AccessionMI0024084 (change log)
DescriptionOrnithorhynchus anatinus miR-7424 stem-loop
Stem-loop
   ---au         a       a  ccg 
5'      cugccaguu cucugua gc   a
        ||||||||| ||||||| ||    
3'      gacggucga ggggcau cg   g
   ccuac         c       c  uau 
Get sequence
Deep sequencing
894 reads, 33.3 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra183: 287307-287361 [-]
sense
ENSOANT00000022496 ; oan-mir-7424-201; exon 1
ENSOANT00000022497 ; oan-mir-7424-202; exon 1
Database links

Mature sequence oan-miR-7424-5p

Accession MIMAT0028998
Sequence

1 - 

aucugccaguuacucuguaagc

 - 22

Get sequence
Deep sequencing892 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7424-3p

Accession MIMAT0028999
Sequence

33 - 

cuacggggcagcuggcagcaucc

 - 55

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).