Stem-loop sequence oan-mir-7423

AccessionMI0024083 (change log)
DescriptionOrnithorhynchus anatinus miR-7423 stem-loop
Stem-loop
   --       g   u         g uuuaa 
5'   uauucuu ucc cuuguccag c     c
     ||||||| ||| ||||||||| |     a
3'   guaagaa agg gaacagguc g     a
   cc       a   u         - uacau 
Get sequence
Deep sequencing
1242 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra139: 334073-334132 [+]
sense
ENSOANT00000009153 ; ARHGAP26-201; intron 15
Database links

Mature sequence oan-miR-7423-5p

Accession MIMAT0028996
Sequence

1 - 

uauucuuguccucuuguccagg

 - 22

Get sequence
Deep sequencing661 reads, 4 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7423-3p

Accession MIMAT0028997
Sequence

39 - 

uggacaaguggaaaagaaugcc

 - 60

Get sequence
Deep sequencing581 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).