Stem-loop sequence oan-mir-7422a

AccessionMI0024082 (change log)
DescriptionOrnithorhynchus anatinus miR-7422a stem-loop
Stem-loop
   uc        cu   -      cuu  a 
5'   uugagaga  cuu gaagug   ug u
     ||||||||  ||| ||||||   || u
3'   agcuuucu  gag cuucac   ac c
   ac        cg   u      ---  u 
Get sequence
Deep sequencing
59 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra10: 583053-583107 [+]
sense
ENSOANT00000020075 ; TNIK-201; intron 42
Database links

Mature sequence oan-miR-7422a-5p

Accession MIMAT0028994
Sequence

1 - 

ucuugagagacucuugaagugc

 - 22

Get sequence
Deep sequencing53 reads, 3 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7422a-3p

Accession MIMAT0028995
Sequence

35 - 

acuucugaggcucuuucgaca

 - 55

Get sequence
Deep sequencing6 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).