Stem-loop sequence oan-mir-7421

AccessionMI0024081 (change log)
DescriptionOrnithorhynchus anatinus miR-7421 stem-loop
Stem-loop
   --                      aaua  aa 
5'   ugugucuagucccuauauaauu    au  u
     ||||||||||||||||||||||    ||   
3'   acacagaucagggauauauuaa    ua  u
   ga                      ---g  ag 
Get sequence
Deep sequencing
52 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Ultra10: 467137-467197 [+]
sense
ENSOANT00000020075 ; TNIK-201; intron 13
Database links

Mature sequence oan-miR-7421-5p

Accession MIMAT0028992
Sequence

1 - 

ugugucuagucccuauauaauu

 - 22

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7421-3p

Accession MIMAT0028993
Sequence

40 - 

uuauauagggacuagacacaag

 - 61

Get sequence
Deep sequencing50 reads, 5 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).