Stem-loop sequence oan-mir-26-2

AccessionMI0024080 (change log)
DescriptionOrnithorhynchus anatinus miR-26-2 stem-loop
Gene family MIPF0000043; mir-26
Stem-loop
   --uu         c           - g  c 
5'     caaguaauc aggauaggcug u ug g
       ||||||||| ||||||||||| | ||  
3'     guucauugg ucuuguccggu a ac c
   cccc         c           u g  u 
Get sequence
Deep sequencing
289370 reads, 5.34e+03 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig8967: 32534-32594 [+]
sense
ENSOANT00000025842 ; oan-mir-26-2-201; exon 1
ENSOANT00000024915 ; CTDSPL-201; intron 5
Database links

Mature sequence oan-miR-26-5p

Accession MIMAT0006991
Previous IDsoan-miR-26
Sequence

1 - 

uucaaguaauccaggauaggcu

 - 22

Get sequence
Deep sequencing579498 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

Mature sequence oan-miR-26-2-3p

Accession MIMAT0031115
Sequence

40 - 

ccuguucucgguuacuugcccc

 - 61

Get sequence
Deep sequencing53 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).