Stem-loop sequence oan-mir-7420

AccessionMI0024079 (change log)
DescriptionOrnithorhynchus anatinus miR-7420 stem-loop
Stem-loop
   --ua         ugug   -     caccu    
5'     gcugcugug    ugg ccaua     gca 
       |||||||||    ||| |||||     || u
3'     cgacgacac    gcu gguau     cgu 
   cuua         ---u   a     ---uu    
Get sequence
Deep sequencing
63 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig8723: 12562-12621 [+]
intergenic
Database links

Mature sequence oan-miR-7420-5p

Accession MIMAT0028990
Sequence

1 - 

uagcugcuguguguguggccauaca

 - 25

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7420-3p

Accession MIMAT0028991
Sequence

38 - 

uauggaucgucacagcagcauuc

 - 60

Get sequence
Deep sequencing62 reads, 3 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).