Stem-loop sequence oan-mir-34b

AccessionMI0024078 (change log)
DescriptionOrnithorhynchus anatinus miR-34b stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   --a       u      c      gaccau 
5'    ggcagug aguuag ugauug      c
      ||||||| |||||| ||||||       
3'    ccgucac ucaauc acuaac      c
   cua       c      -      gcccgc 
Get sequence
Deep sequencing
44322 reads, 1.56e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig8579: 9814-9872 [-]
sense
ENSOANT00000025617 ; oan-mir-34b-201; exon 1
Clustered miRNAs
< 10kb from oan-mir-34b
oan-mir-34bContig8579: 9814-9872 [-]
oan-mir-34aContig8579: 8107-8196 [-]
Database links

Mature sequence oan-miR-34b-5p

Accession MIMAT0028988
Sequence

1 - 

aggcaguguaguuagcugauugg

 - 23

Get sequence
Deep sequencing43871 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-34b-3p

Accession MIMAT0028989
Sequence

38 - 

aaucacuaacuccacugccauc

 - 59

Get sequence
Deep sequencing451 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).