Stem-loop sequence oan-mir-7419

AccessionMI0024077 (change log)
DescriptionOrnithorhynchus anatinus miR-7419 stem-loop
Stem-loop
   - c    c  cc             --  u 
5'  g uuca ag  cuucuaaacaagu  cc u
    | |||| ||  |||||||||||||  || g
3'  c aagu uc  gaagauuuguucg  gg a
   g c    u  ua             ua  a 
Get sequence
Deep sequencing
190 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
2: 41358556-41358615 [+]
sense
Database links

Mature sequence oan-miR-7419-5p

Accession MIMAT0028986
Sequence

1 - 

gcuucacagcccuucuaaacaag

 - 23

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7419-3p

Accession MIMAT0028987
Sequence

39 - 

uguuuagaagaucuuugaaccg

 - 60

Get sequence
Deep sequencing189 reads, 4 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).