Stem-loop sequence oan-mir-124a-2

AccessionMI0024076 (change log)
DescriptionOrnithorhynchus anatinus miR-124a-2 stem-loop
Gene family MIPF0000021; mir-124
Stem-loop
   --c        a c -ga        uaau 
5'    guguucac g g   ccuugauu    g
      |||||||| | |   ||||||||    u
3'    cguaagug c c   ggaauuaa    c
   aac        g u acg        caua 
Get sequence
Deep sequencing
1549 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig82070: 3788-3847 [-]
sense
ENSOANT00000032934 ; oan-mir-124a-2-201; exon 1
Database links

Mature sequence oan-miR-124a-5p

Accession MIMAT0007113
Previous IDsoan-miR-124*
Sequence

1 - 

cguguucacagcggaccuugau

 - 22

Get sequence
Deep sequencing3061 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-124a-2-3p

Accession MIMAT0031068
Sequence

39 - 

aagggcacucggugaaugccaa

 - 60

Get sequence
Deep sequencing77 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).