Stem-loop sequence oan-mir-7418

AccessionMI0024075 (change log)
DescriptionOrnithorhynchus anatinus miR-7418 stem-loop
Stem-loop
   --  -u      g        cu c ug   a 
5'   cg  aucucu gagcgcuu  g g  cgg g
     ||  |||||| ||||||||  | |  |||  
3'   gc  uagagg cucgcgag  c c  guc c
   ca  cu      g        -- - gu   g 
Get sequence
Deep sequencing
53 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig6972: 29066-29125 [-]
sense
ENSOANT00000005151 ; SLC25A18-201; intron 5
Database links

Mature sequence oan-miR-7418-5p

Accession MIMAT0028984
Sequence

1 - 

cguaucucuggagcgcuucugc

 - 22

Get sequence
Deep sequencing19 reads, 2 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-7418-3p

Accession MIMAT0028985
Sequence

38 - 

ccgagcgcucgggagauuccgac

 - 60

Get sequence
Deep sequencing8 reads, 2 experiments
Evidence experimental; Illumina [1]

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).