Stem-loop sequence oan-mir-24-2

AccessionMI0024074 (change log)
DescriptionOrnithorhynchus anatinus miR-24-2 stem-loop
Gene family MIPF0000041; mir-24
Stem-loop
   --  g   a         aa g     gcuu 
5'   gu ccu cugagcuga  c caguu    u
     || ||| |||||||||  | |||||     
3'   ca gga gacuugacu  g gucaa    g
   ga  a   c         -c -     auuc 
Get sequence
Deep sequencing
176417 reads, 2.36e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (OANA5) Overlapping transcripts
Contig6812: 3735-3794 [+]
sense
ENSOANT00000025275 ; oan-mir-24-2-201; exon 1
Clustered miRNAs
< 10kb from oan-mir-24-2
oan-mir-23aContig6812: 2753-2836 [+]
oan-mir-23aContig6812: 3296-3379 [+]
oan-mir-27aContig6812: 3490-3574 [+]
oan-mir-24-2Contig6812: 3735-3794 [+]
Database links

Mature sequence oan-miR-24-2-5p

Accession MIMAT0031092
Sequence

1 - 

gugccuacugagcugaaacgcagu

 - 24

Get sequence
Deep sequencing1199 reads, 5 experiments
Evidence experimental; Illumina [1]

Mature sequence oan-miR-24-3p

Accession MIMAT0006955
Previous IDsoan-miR-24
Sequence

39 - 

uggcucaguucagcaggaacag

 - 60

Get sequence
Deep sequencing519160 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links

References

1
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).